New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_007779	1221489 =	3 (0.010)	292 (0.820)	135/176	NT	99.0%	intergenic (+711/+2393)	ymgF/ymgD	hypothetical protein/hypothetical protein
	?	NC_007779	1301041 =	NA (NA)					intergenic (+219/‑89)	ychE/insC	inner membrane protein/IS2 element protein

TTGAAATGA‑TATTAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAATACTAGTTTTTAGACTAGTCATTGGAGAA  >  NC_007779/1301027‑1301126                |                                                                                      tgcaaaTGAGTATTAGACTGGCCTCCTGAATCTCCAGAGAACCAATATCACTTAAATAAGTGATAGTCCTAATACTAGTTTTTAGACTAGTCATTGGAGaa  <  1:16761007/98‑1 (MQ=11)                |                                                                                      TTGAAATGA‑TATTAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAATACTAGTTTTTAGACTAGTCATTGGAGAA  >  NC_007779/1301027‑1301126

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 20 ≤ ATCG/ATCG < 31 ≤ ATCG/ATCG < 35 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.