New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_007779	3746911 =	NA (NA)	377 (1.060)	145/180	NT	100%	intergenic (‑509/‑68)	mdtL/insH	multidrug efflux system protein/IS5 element protein
	?	NC_007779	= 3748646	0 (0.000)					intergenic (+687/+425)	insH/tnaA	IS5 element protein/tryptophanase/L‑cysteine desulfhydrase, PLP‑dependent

GCCGTGGGAGTTATCAATCTTAAACAGGTCCGCCAGATAATCGAACAACCCCAGCGTGACACCAAAGAACGAACTGGCAACAGCTAAGTTAGGGAAGGTGC  >  NC_007779/3746819‑3746919                                                                                             |         gccgTGGGAGTTATCAATCTTAAACAGGTCCGCCAGATAATCGAACAACCCCAGCGTGACACCAAAGACCGAACTGGCAACACCAAAGTTAGAGaccccca  >  1:7128345/1‑95 (MQ=255)                                                                                             |         GCCGTGGGAGTTATCAATCTTAAACAGGTCCGCCAGATAATCGAACAACCCCAGCGTGACACCAAAGAACGAACTGGCAACAGCTAAGTTAGGGAAGGTGC  >  NC_007779/3746819‑3746919

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 31 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 40 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.