New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_007779	= 1221495	0 (0.000)	219 (0.780)	119/180	NT	100%	intergenic (+717/+2387)	ymgF/ymgD	hypothetical protein/hypothetical protein
	?	NC_007779	= 1302369	NA (NA)					intergenic (+11/‑527)	insD/oppA	IS2 element protein/oligopeptide transporter subunit

CTGGGTTATCGCTCGCCACGGGAATATCTGCGGCAGCGGGCTTGTAATGGGTTAAGTGATAACAGATGTCTGGAAATATAGGGGCAAATCCAGATATTATT  >  NC_007779/1302278‑1302378                                                                                            |          cTGGGTTATGGCTCGCCACGGGAGTAGCGGCGGCGGCGGGCTTGAAATGGGTTAAGTGATAACAGATGTCTGGTAATATAAGGGTAAATCCAGGtatttat  >  1:12241819/1‑98 (MQ=11)                                                                                            |          CTGGGTTATCGCTCGCCACGGGAATATCTGCGGCAGCGGGCTTGTAATGGGTTAAGTGATAACAGATGTCTGGAAATATAGGGGCAAATCCAGATATTATT  >  NC_007779/1302278‑1302378

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.